Nucleotide Sequence Homology Exists between the Chloroplast and Nuclear Ribosomal DNAs of Euglena gracilis.

نویسندگان

  • S E Curtis
  • J R Rawson
چکیده

The nuclear and chloroplast ribosomal DNAs from Euglena were shown to have specific regions of nucleotide sequence homology. The regions of homology were identified by hybridization of restriction endonuclease DNA fragments of cloned chloroplast and nuclear ribosomal DNAs to one another. The regions of homology between these two ribosomal DNAs were in that part of the genes that code for the 3' end of the small rRNAs (16S and 19S) and near or at the DNA sequences coding for the 5S RNAs. The nucleotide sequence homology between these regions was estimated to be approximately 94% by the melting point depression of a hybrid formed between the two ribosomal DNAs.

برای دانلود متن کامل این مقاله و بیش از 32 میلیون مقاله دیگر ابتدا ثبت نام کنید

ثبت نام

اگر عضو سایت هستید لطفا وارد حساب کاربری خود شوید

منابع مشابه

Identification and comparative analysis of the chloroplast alpha-subunit gene of DNA-dependent RNA polymerase from seven Euglena species.

When the sequence of the Euglena gracilis chloroplast genome was reported in 1993 the alpha-subunit gene (rpoA) of RNA polymerase appeared to be missing, based on a comparison of all putative reading frames to the then known rpoA loci. Since there has been a large increase in known rpoA sequences, the question of a Euglena chloroplast rpoA gene was re-examined. A previously described unknown re...

متن کامل

The Phylogeny of Calligonum and Pteropyrum (Polygonaceae) Based on Nuclear Ribosomal DNA ITS and Chloroplast trnL-F Sequences

This study represents phylogenetic analyses of two woody polygonaceous genera Calligonum and Pteropyrum using both chloroplast fragment (trnL-F) and the nuclear ribosomal internal transcribed spacer (nrDNA ITS) sequence data. All inferred phylogenies using parsimony and Bayesian methods showed that Calligonum and Pteropyrum are both monophyletic and closely related taxa. They have no affinity w...

متن کامل

The nucleotide sequence of 5S rRNA from a red alga, Porphyra yezoensis.

The nucleotide sequence of 5S rRNA from Porphyra yezoensis has been determined to be: pACGUACGGCCAUAUCCGAGACACGCGUACCGGAACCCAUUCCGAAUUCCGAAGUCAAGCGUCCGCGAGUUGGGUUAGU - AAUCUGGUGAAAGAUCACAGGCGAACCCCCAAUGCUGUACGUC. This 5S rRNA sequence is most similar to that of Euglena gracilis (63% homology).

متن کامل

The Euglena gracilis chloroplast ribulose-1,5-bisphosphate carboxylase gene. I. Complete DNA sequence and analysis of the nine intervening sequences.

The nucleotide sequence of 6225 base pairs (bp) of Euglena gracilis chloroplast DNA including the complete DNA sequence of the chloroplast-encoded ribulose-1,5-bisphosphate carboxylase large subunit gene along with the flanking DNA sequences is presented. The gene is greater than 5.5 kilobase pairs in length and is organized as 10 exons coding for 475 amino acids, separated by 9 introns. The ex...

متن کامل

Euglena gracilis chloroplast ribosomal protein operon: a new chloroplast gene for ribosomal protein L5 and description of a novel organelle intron category designated group III.

We describe the structure (3840 bp) of a novel Euglena gracilis chloroplast ribosomal protein operon that encodes the five genes rpl16-rpl14-rpl5-rps8-rpl36. The gene organization resembles the spc and the 3'-end of the S10 ribosomal protein operons of E. coli. The rpl5 is a new chloroplast gene not previously reported for any chloroplast genome to date and also not described as a nuclear-encod...

متن کامل

ذخیره در منابع من


  با ذخیره ی این منبع در منابع من، دسترسی به آن را برای استفاده های بعدی آسان تر کنید

برای دانلود متن کامل این مقاله و بیش از 32 میلیون مقاله دیگر ابتدا ثبت نام کنید

ثبت نام

اگر عضو سایت هستید لطفا وارد حساب کاربری خود شوید

عنوان ژورنال:
  • Plant physiology

دوره 69 1  شماره 

صفحات  -

تاریخ انتشار 1982